I made this for my science class. its A thing that turns DNA and makes an RNA code from it and then makes a sequence of amino acids from the RNA. you have to use the letters TCAG and preferably have the length be a multiple of 3(it does 3 at a time) HERE IS A SAMPLE CODE TO USE!: CCCTGTGGAGCCACACCCTAG(use ctrl/command + v to paste. read about it here: http://en.wikipedia.org/wiki/Genetic_code
